Sequenced RAD Markers for Rapid SNP Discovery and Genetic Mapping
Paul D. Etter
2. Materials
2.1. DNA extraction and RNase A treatment
1. DNeasy Blood & Tissue Kit (Qiagen).
2. RNaseA (Qiagen).
2.2. Restriction endonuclease digestion
1. Restriction enzyme (NEB).
2. Clean, intact high-quality genomic DNA: 25 ng/μl.
2.3. P1 Adapter ligation
1. NEB Buffer 2.
2. rATP (Promega): 100 mM.
3. P1 Adapter: 100 nM. A modified Solexa adapter (2006 Illumina, Inc., all rights reserved). Prepare 100nM stocks of P1 adapters in 1X Annealing Buffer (AB, see Note 4). Below, example barcoded EcoRI P1 adapter sequences. “P” denotes a phosphate group and “x” refers to barcode nucleotides.
P1 top:
5´- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxx-
xxx -3´
P1 bottom:
5´- P-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG-
TATCATT -3´
4. Concentrated T4 DNA Ligase (NEB): 2,000,000 U/ml.
2.4. Purification steps
1. QIAquick or MinElute PCR Purification Kit (Qiagen).
2.5. DNA shearing
1. Bioruptor, nebulizer or Branson sonicator 450.
2.6. Size selection/agarose gel extraction
1. Agarose (Sigma)
2. 5X TBE: 0.45 M Tris-Borate, 0.01 M EDTA, pH 8.3.
3. 6X Orange Loading Dye Solution (Fermentas).
4. GeneRuler 100 bp DNA Ladder Plus (Fermentas).
5. Razor blades.
6. MinElute Gel Purification Kit (Qiagen).
2.7. Perform end repair
1. Quick Blunting Kit (NEB).
2.8. 3´-dA overhang addition
1. NEB Buffer 2.
2. dATP (Fermentas): 10 mM.
3. Klenow Fragment (3´ to 5´ exo-, NEB): 5,000 U/ml.
2.9. P2 Adapter ligation
1. NEB Buffer 2.
2. rATP: 100 mM.
3. P2 Adapter: 10 μM. A modified Solexa adapter (2006 Illumina, Inc., all rights reserved). Prepare 10 μM double-stranded adapter in 1X AB (see Note 4). Asterisk denotes a phosphorothioate bond introduced to confer nuclease resistance to the double-stranded oligo (14).
P2 top:
5´-...